This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.

Virulence Gene’s Relationship With Biofilm Formation and Detection of aac (6’)/aph (2”) in Enterococcus faecalis Isolated From Patients With Urinary Tract Infection


1 Department of Microbiology and Immunology, Faculty of Medicine, Kashan University of Medical Sciences, Kashan, IR Iran
2 Anatomical Sciences Research Center, Kashan University of Medical Sciences, Kashan, IR Iran
3 Department of Statistic , Health Faculty, Kashan University of Medical Sciences, Kashan, IR Iran
*Corresponding author: Rezvan Moniri, Department of Microbiology and Immunology, Faculty of Medicine, Kashan University of Medical Sciences, Kashan, IR Iran. Tel: +98-3615550021-25, Fax: + 98-3615551112, E-mail: moniri@kaums.ac.ir.
Jundishapur Journal of Microbiology. 2013 July; 6(5): e6244 , DOI: 10.5812/jjm.6244
Article Type: Research Article; Received: May 9, 2012; Revised: Sep 19, 2012; Accepted: Nov 7, 2012; epub: Jul 1, 2013; ppub: Jul 2013
Running Title: Virulence Genes Relationship With Biofilm Formation in E. faecalis

Abstract


Objectives: We investigated the potential relationships between biofilm formation and prevalence of virulence genes (asa1, esp, cylA, and gelE/sprE), and antimicrobial resistance genes (aac (6’)/aph (2”) in Enterococcus faecalis isolated from patients with urinary tract infection.

Patients and Methods: In this survey 95 E. faecalis isolates from patients with urinary tract infections staying at Shahid Beheshti hospital in Kashan, Iran, between 2007 and 2008 were studied. We analyzed the prevalence of genes encoding virulence factors (asa1, esp, cylA and gelE/ sprE), and antimicrobial resistance genes [(aac (6’)/aph (2”)] by PCR. In addition, the production of biofilm and extracellular enzymes, hemolysin (Hln) and Gelatinase were examined.

Results: The asa1,(aac (6’)/aph (2”), esp, cylA, and gelE/sprE were detected in 94.7%, 68.4%, 61.1%, 50.5% and 21.1% of E. faecalis isolates, respectively. The hemolysin production and gelatinase activity were seen in 44.2% and 20% of isolates, respectively. 16.8% of E. faecalis isolates showed strong and 83.2% exhibited weak biofilm formation. The percentages of genes encoding virulence factors in E. faecalis which had the ability of strong biofilm formation were as follows: gelE/sprE 25%, esp22.4%, (aac (6’)/aph (2”) 18.5%, asa1 16.7% and cylA 14.6%. The presence of both aac (6’)/aph (2”) and esp positive act as a risk factor for biofilm formation (P value < 0.001).

Conclusions: There was a significant relationship between biofilm formation and possession of esp and aac (6’)/aph (2”) genes. There was no evidence between biofilm formation and presence of any other gene. Enterococcal infections associated with biofilm formation have been a serious problem in recent years.

Keywords: Enterococcus faecalis; Biofilms; Urinary Tract Infection

1. Background


Enterococcus faecalis is part of the normal flora of the human gastrointestinal tract, and also an opportunistic pathogen, which is considered as a major cause of nosocomial infections (1). According to some reports E. faecalis has been isolated from up to 20% of urinary tract infections (2). One of the important virulence factors of enterococci is their ability to form biofilms (3). This property in some strains of E. faecalis may increase their ability to colonize in patients and remain in infection sites. Biofilms are bacterial populations that are found as surface-attached aggregates enclosed in an exopolymer matrix. Bacteria with biofilm forming ability are thought to be more resistant to antibiotics than the corresponding free-living bacteria, thus causing the problem of antimicrobial resistance. Furthermore, some studies report that over 65% of hospital-acquired infections occur due to biofilm producing ability of the infecting organisms (4). Several virulence factors such as enterococcal surface protein (ESP), cytolysin (Cyl), aggregation substances (Agg) and gelatinase (Gel) have been described in E. faecalis.

These factors participate in synergy and increase the virulence of E. faecalis. Esp which is encoded by the chromosomal esp, is a cell wall associated protein in E. faecalis isolates and it has been shown that Esp may increase the existence of E. faecalis in urinary tracts during experimental urinary tract infections (UTIs) (1, 5, 6). The other virulence gene in E. faecalis is Cyl that has the ability to lyse eukaryotic cells including macrophages and polymorphonuclear neutrophils (7). The actions of Cyl increase the virulence of human enterococcal infections (2, 7).

Cytolys in genes are found on a plasmid or are integrated into the bacterial chromosome (8). Another virulence gene is the chromosomal gel E which encodes Gel. Gelatinase is an extracellular zinc endopeptidase that hydrolyzes collagen, gelatin, and small peptide chains (8). Gelatinase producing strains of E. faecalis have been shown to contribute to the severity of endocarditis in an animal model (8). Hemolysin is a cytolytic protein capable of lysis of human, horse and rabbit erythrocytes. Hemolysin producing strains are found to be associated with increased severity of infections (6).

The aggregation substance, expressed by asa1, which is located on a plasmid, is a pheromone-inducible protein that enables the conjugative transfer of sex pheromone gene-containing plasmids through the clumping of one Enterococcus to another. As a virulence factor, the aggregation substance enhances bacterial adherence to renal tubular cells and endocardial cells (8). The enzymes aac (6’) and aph (2”) inactivate the most frequently used aminoglycosides in clinical practice. These modifying enzymes include aminoglycoside acetyltransferase (aac) and aminoglycoside phosphoryltransferase (aph).

2. Objectives


In this study we investigated the relationships between biofilm formation and harboring virulence genes (asa1, esp, cylA, gelE, sprE) and the resistance-modifying enzyme genes, aac (6’) and aph (2”).

3. Patients and Methods


The E. faecalis isolates used in this study were isolated from hospitalized patients with complicated UTI staying at Shahid Beheshti hospital in Kashan, Iran, between 2007 and 2008. A total of 600 patients, which confirmed pyuria (WBC ≥ 5/ hpf) with ≥104 CFU/mL in their urinary culture were selected for this study. Urine samples were cultured on blood agar and Mac Conkey agar and incubated at 37˚C for 24 hours. Positive cultures were confirmed by gram staining and standard biochemical tests such as: catalase, PYR and growing on media containing 6.5% salt. Biofilm formation was examined as described previously (2). The culture was diluted to 1:100 in medium and 200µl of this cell suspension was used to inoculate sterile flat-bottomed 96-well polystyrene microtitre plates (BD Biosciences). After 24 h at 37˚C, wells were gently washed three times with 300μl of distilled water, dried in an inverted position, and stained with 300µl of 2% crystal violet solution in water for 45min. After staining, plates were washed 3 times with distilled water.

Quantitative analysis of biofilm formation was performed, by adding 300µl of ethanol-acetic acid (95:5,vol/vol) to de-stain the wells. Finally, 100µl from each well was transferred to a new polystyrene microtitre plate and the level (optical density; OD) of crystal violet was measured at 570nm using a ELIZA plate reader. Each assay was performed in triplicate. As a control, un-inoculated medium was used to determine background OD. The mean OD 570 value from the control wells was subtracted from the mean OD 570 value of tested wells . According to OD, the isolated bacteria were classified in two groups of strong and weak biofilm formers. OD 570 ≥ 0.2 was described as strong biofilm formation versus OD570 < 0.2 as weak biofilm formation isolates.

Bacterial DNA was extracted by a boiling method. Primers reported by Kariyama et al., were used for amplification of the genes of E. faecalis (9). For detection of esp, gelE/sprE, cylA, asa1,acc (6')/aph(2'') genes in E. faecalis strain, we used the primers reported by Seno et al.. (2). The primers used in this study for detecting E. faecalis , esp, gelE/sprE, cylA, asa1, acc(6')/aph(2'') genes are summarized in Table 1.

Table 1.
Primers for Amplification of Genes From E. faecalis Isolates

Total cellular DNA was prepared as follows: E. faecalis culture grown overnight on Blood agar or TSB was transferred to a 250µl Eppendorf vial, then centrifuged at 10000 rpm for 10 min. The supernatant was discarded and 250µl of distilled water was added to the pellet, and resulting solution was heated for 15 min at 100˚C, and centrifuged at 10000 rpm for 10 min. The supernatant was transferred to a new microtube, and stored at -20 ˚C. Primers were added to the reaction mixture; the 25µl reaction volume contained 0.2mM of each dNTP(dATP, dCTP, dGTP, dTTP),10 mMTris-HCL (PH 8.3), 50 mM KCL, 1.5 mM Mgcl 2 and1U Top DNA polymerase, PCR conditions are shown in Table 1. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel. After electrophoresis, gel was stained with ethidium bromide and photographed under a UV trans-illuminator (INGENIUS, SYNGENE). A 100-bp DNA (Bio NEER, Korea) ladder was used as a molecular size marker. The data were compared using the chi-square test or Fisher's exact test with SPSS version 16 for Windows (SPSS, Chicago, IL). A P value of < 0.05 was considered significant.

4. Results


From the total of 114 isolated enterococcus strains 95 (83.3%) were recognized as E. faecalis and 19 (16.7%) of them were E. faecium. The mean age for the studied population was 39.20 years (± 20.06), which ranged between 1 and 91 years. E. faecalis isolates were recovered from 95 patientsincluding 48 men (50.5%) and 47 women (49.5%). By using PCR, asa1, acc (6')/aph (2''), esp , cylA, gelE/sprE genes were found in 90 (94.7%), 65 (68.4%), 58 (61.1%), 48 (50.5%) and 20 (21.1%) of the isolates, respectively. The findings indicate that 58.3% of isolates (28 out of 48) possessing the cylA gene, produced hemolysin (P value < 0.005). Biofilm formation assay showed that 16.8% (16 out of 95) of E. faecalis isolates contribute to a strong (OD570 ≥ 0.2), while 83.2% (79 out of 95) exhibit weak (OD570 < 0.2) biofilm formation. The relationshipbetween biofilm-forming capacities and virulence genes are summarized in Table 2.

Table 2.
Relationship Between Strong Biofilm-Forming and Virulence Factors in 95 E. faecalis Isolates

There wereno statistically significant differences between asa1, acc (6')/aph (2''), esp, cylA, gelE/sprE genes with application of catheter on biofilm formation. The occurrence of E. faecalis isolates possessing aac (6')-aph (2"), which inactivate all of the most frequently used aminoglycosides inclinical practice, were high in our study. The Percentage ofpositive virulence genes (asa1, esp, cylA and gelE/sprE) and acc (6')/aph (2'') isolates in 95 of the E. faecalis isolates are presented in Figure 1. Comparison of strong and weak biofilm-formation ability of the 95 isolates of E. faecalis based on the presence of virulence genes (asa1, esp, cylAand gelE/sprE) and acc (6')/aph (2'') are shown in Figure 2.

Figure 1.
Percentage of Virulence Genes (asa1, esp, cylA and gelE/sprE) and acc (6')/aph (2'') Positive Isolates in 95 of E. faecalis Isolates
Figure 2.
Biofilm- Forming Ability of 95 Isolates of E. faecalis Based on the Presence of Virulence Genes (asa1, esp, cylA and gelE/sprE) and acc (6')/aph (2'')

5. Discussion


Our data indicated that E. faecalis possessing aac (6’)/aph (2”), esp and asa1 were predominant. The study results confirm the presence of a statistically significant relationship between esp and aac (6’)/aph (2”) genes (P value < 0.001), but the relationship between the possession ofaac (6’)/aph (2”) and other virulence genes was not significant. There was a significant relationship between the presence of esp and aac (6’)/ aph (2”) genes and biofilm formation. The presence of both aac (6’)/aph (2”) and esp positive act as a risk factor for biofilm formation (P value < 0.001).

The odds ratio (OR) was 51.6 (95% confidence interval [CI], 10.4 to 255.11), which suggests a significant influence of aac (6’)/aph (2”) and esp positive on biofilm formation. With regard to biofilm formation, there have been different reports on the role of Esp and Gel. A strong association between the presence of Esp and the ability of enterococal strain to form biofilms in vitro has been described (10). These findings are in agreement with the results of Seno et al. in their article the biofilm forming abilities were significantly higher in esp-positive isolates (2). Marra and coworkers did not find any direct relationship between the expression of esp, gel and biofilm formation, but showed that the combination of these factors may play a role in allowing a more treatment resistant in vivo biofilm (11).

Kristich et al. demonstrated that in vitro biofilm formation occurs, not only in the absence of esp, but also in the lack of the entire pathogenicity island that harbors the esp coding sequence (12). Mohamed et al., reported that esp was not required to form biofilm (13). They showed that all 74 esp-positive isolates produced biofilm, and 77 of 89 esp-negative isolates also produced biofilm (13). The otherstudies confirmed that this protein is a predisposing or an important factor for biofilm formation, but is not completely necessary (10, 14). The capacity of biofilm formation is not restricted to the esp positive isolates. Hammerum et al., reported gentamicin-resistant E. faecalis in esp-positive isolates from human, which were encoded by aac (6′)-Ie-aph (2")-Ia from patients in a Danish hospitals (15).

In this study, there were no statistically significant differences between biofilm–forming capacities and the presence of catheter. Biofilm formation by E. faecalis occurs in response to any bacterial factors that is related to the extracellular matrix of the host This study showed a statistically significant relationship between esp and aac (6’)/aph (2”) genes. Our study indicates that E. faecalis isolates that have both esp and aac (6’)/aph (2”)genes form strong biofilms in the urinary tract. This study suggests that further investigation is necessary to better understand the relationship of virulence genes of this pathogen.

Acknowledgments

The manuscript was based on the thesis of MSc degree and was supported by Kashan University of Medical Sciences Research fund.

Footnotes

Implication for health policy/practice/research/medical education: Enterococcal infections associated with biofilm formation have been a serious problem in recent years. We investigated the potential relationships between biofilm formation and prevalence of virulence genes (asa1, esp, cylA, and gelE/sprE), and antimicrobial resistance genes aac (6’) / aph (2”) in E. faecalis isolated from patients with urinary tract infection.
Authors’ Contribution: None declared.
Financial Disclosure: None declared.
Funding/Support: None declared.
Please cite this paper as: Moniri R. Ghasemi A, Moosavi SGA, Dastehgoli K, Rezaei M. Virulence Genes Relationship With Biofilm Formation and Detection of aac(6’) / aph(2”) in E. faecalis Isolated From Patients With Urinary Tracts Infection. Jundishapur J Microbiol. 2013; 6(5):e6244.

References


  • 1. Gao P, Pinkston KL, Nallapareddy SR, van Hoof A, Murray BE, Harvey BR. Enterococcus faecalis rnjB is required for pilin gene expression and biofilm formation. J Bacteriol. 2010;192(20):5489-98. [DOI] [PubMed]
  • 2. Seno Y, Kariyama R, Mitsuhata R, Monden K, Kumon H. Clinical implications of biofilm formation by Enterococcus faecalis in the urinary tract. Acta Med Okayama. 2005;59(3):79-87. [PubMed]
  • 3. Garsin DA, Willems RJ. Insights into the biofilm lifestyle of enterococci. Virulence. 2010;1(4):219-21. [DOI] [PubMed]
  • 4. Del Papa MF, Hancock LE, Thomas VC, Perego M. Full activation of Enterococcus faecalis gelatinase by a C-terminal proteolytic cleavage. J Bacteriol. 2007;189(24):8835-43. [DOI] [PubMed]
  • 5. Giridhara Upadhyaya PM, Ravikumar KL, Umapathy BL. Review of virulence factors of enterococcus: an emerging nosocomial pathogen. Indian J Med Microbiol. 2009;27(4):301-5. [DOI] [PubMed]
  • 6. Giridhara Upadhyaya PM, Umapathy BL, Ravikumar KL. Comparative study for the presence of enterococcal virulence factors gelatinase, hemolysin and biofilm among clinical and commensal isolates of enterococcus faecalis. J Lab Physicians. 2010;2(2):100-4. [DOI] [PubMed]
  • 7. Miyazaki S, Ohno A, Kobayashi I, Uji T, Yamaguchi K, Goto S. Cytotoxic effect of hemolytic culture supernatant from Enterococcus faecalis on mouse polymorphonuclear neutrophils and macrophages. Microbiol Immunol. 1993;37(4):265-70. [PubMed]
  • 8. Biendo M, Adjide C, Castelain S, Belmekki M, Rousseau F, Slama M, et al. Molecular characterization of glycopeptide-resistant enterococci from hospitals of the picardy region (france). Int J Microbiol. 2010;2010:150464. [DOI] [PubMed]
  • 9. Kariyama R, Mitsuhata R, Chow JW, Clewell DB, Kumon H. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant enterococci. J Clin Microbiol. 2000;38(8):3092-5. [PubMed]
  • 10. Toledo-Arana A, Valle J, Solano C, Arrizubieta MJ, Cucarella C, Lamata M, et al. The enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation. Appl Environ Microbiol. 2001;67(10):4538-45. [PubMed]
  • 11. Marra A, Dib-Hajj F, Lamb L, Kaczmarek F, Shang W, Beckius G, et al. Enterococcal virulence determinants may be involved in resistance to clinical therapy. Diagn Microbiol Infect Dis. 2007;58(1):59-65. [DOI] [PubMed]
  • 12. Kristich CJ, Li YH, Cvitkovitch DG, Dunny GM. Esp-independent biofilm formation by Enterococcus faecalis. J Bacteriol. 2004;186(1):154-63. [PubMed]
  • 13. Mohamed JA, Huang W, Nallapareddy SR, Teng F, Murray BE. Influence of origin of isolates, especially endocarditis isolates, and various genes on biofilm formation by Enterococcus faecalis. Infect Immun. 2004;72(6):3658-63. [DOI] [PubMed]
  • 14. Tendolkar PM, Baghdayan AS, Gilmore MS, Shankar N. Enterococcal surface protein, Esp, enhances biofilm formation by Enterococcus faecalis. Infect Immun. 2004;72(10):6032-9. [DOI] [PubMed]
  • 15. Hammerum AM, Jensen LB. Prevalence of esp, encoding the enterococcal surface protein, in Enterococcus faecalis and Enterococcus faecium isolates from hospital patients, poultry, and pigs in Denmark. J Clin Microbiol. 2002;40(11):4396. [PubMed]

Table 1.

Primers for Amplification of Genes From E. faecalis Isolates

Primer NamePrimer Sequence (5' to 3')CycleInitial DenaturationCyclingFinal ExtensionLength (bp)
E. faecalisF:5'ATCAAGTACAGTTAGTCTTTATTAG-3'305 min, 94ºC1 min,9°C; 1 min 54°C; 1 min,72°C10 min, 72°C941
R:5'ACGATTCAAAGCTAACTGAATCAGT-3'
asa1F:5’GATTCTTCGATTGTGTTGTAAAC-3’ 352 min, 95°C1 min, 95°C; 1 min, 46°C; 1min, 72°C10 min, 72°C380
R:5’GGTGCCACAATCAAATTAGG-3’
espF:5’-TTGCTAATGCTAGTCCACGACC3’ 352 min, 95°C45 sec, 94°C; 45 sec,63°C; 2 min, 72°C7 min, 72°C955
R:5’GCGTCAACACTTGCATTGCCGA-3’
cylAF:5’-GGGGATTGATAGGCTTCATCC-3’352 min, 95°C1 min, 95°C; 1 min, 46°C; 1 min, 72°C10 min, 72°C432
R:5’GCACCGACGGTAATTACAGACTCTAG TCCTCC-3’
gelE/sprEF:5’ATGAAGGGAAATAAAATTTTATC-3’352 min, 94°C30 sec, 94°C ; 30 sec, 48°C; 3 min, 72°C6 min, 72°C2428
R:5’-CTGCTGGCACAGCGGATA-3’
Acc (6')/aph (2'')F: 5’ -CCAAGAGCAATAAGGGCATA-3’5 min, 94°C1 min, 94°C; 1 min, 55°C; 1 min, 72°C10 min, 72°C220
R:5’-CACTATCATAACCACTACCG-3’

Table 2.

Relationship Between Strong Biofilm-Forming and Virulence Factors in 95 E. faecalis Isolates

Virulence FactorsNumber of Isolates No.95Strong Biofilm Formation No.16Weak Biofilm Formation No. 79P value
Acc (6')/aph (2'')0.381
Positive651253
Negative30426
asa 10.611
Positive901575
Negative 514
esp0.059
Positive581345
Negative 37334
cyl A0.375
Positive48741
Negative 47938
gelE/sprE 0.218
Positive20515
Negative 751164
Hemolysing0.076
Hemolysing producing42438
Hemolysingnon producing531241
Gelatinase0.599
Gelatinase producing19316
Gelatinase non producing761663
Catheter0.611
Catheter-related514
Catheter-unrelated901575

Figure 1.

Percentage of Virulence Genes (asa1, esp, cylA and gelE/sprE) and acc (6')/aph (2'') Positive Isolates in 95 of E. faecalis Isolates

Figure 2.

Biofilm- Forming Ability of 95 Isolates of E. faecalis Based on the Presence of Virulence Genes (asa1, esp, cylA and gelE/sprE) and acc (6')/aph (2'')